Assembler-specific examples

This page guides you through the assembler-specific contig graph representations provided by the agtools API, along with explanations of how contig graphs are constructed.


SPAdes contig graph

Files required:

  • GFA file - assembly_graph_with_scaffolds.gfa
  • Contigs file - contigs.fasta
  • Contig paths file - contigs.paths

Below is an example SPAdes assembly graph (note that this is not a real SPAdes output).

H   VN:Z:1.0
S   8925540 ACGTAC
S   8925544 CGTACGT
S   8925548 GTACGTA
S   8925552 TACGTAG
L   8925540 +   8925544 +   5M
L   8925544 +   8925548 +   5M
L   8925548 +   8925552 +   5M
P   NODE_1_length_13_cov_20.0   8925540+,8925544+   5M,5M
P   NODE_2_length_21_cov_18.5   8925544+,8925548+,8925552+  5M,5M,5M

SPAdes generates a unitig graph and resolves longer paths as contigs. agtools constructs the contig graph based on prefix–suffix matching of contigs. In other words, if the last segment of one contig matches the first segment of another, a link is created.

For example, the path NODE_1_length_13_cov_20.0 ends with segment 8925544, and NODE_2_length_21_cov_18.5 starts with 8925544.

You can load a SPAdes contig graph as follows. We will use the provided test data.

>>> from agtools.assemblers import spades
>>> graph_file = "tests/data/ESC/assembly_graph_with_scaffolds.gfa"
>>> contigs_file = "tests/data/ESC/contigs.fasta"
>>> contig_paths_file = "tests/data/ESC/contigs.paths"
>>> cg = spades.get_contig_graph(graph_file, contigs_file, contig_paths_file)

You can check the number of vertices (contigs) and edges (connections):

>>> cg.vcount
189
>>> cg.ecount
394

Note

There are fewer contigs than segments (S tags) in the graph (189 contigs and 982 segments in this example) because SPAdes resolves paths with multiple segments into longer contigs. Each contig is made up of one or more segments.

Note

There are also fewer edges than links (L tags) in the graph (394 edges and 1318 links in this example). This is because agtools only represents prefix-suffix overlaps of contigs. Also, the graph is undirected and simplified to remove multiple edges and self-loops.

MEGAHIT contig graph

MEGAHIT assembly graphs represent contig sequences as segments and overlaps between contigs as links, so they are straightforward to interpret. However, when building the graph file from megahit_core, the contigs are renamed.

For example, the first few entries of final.contigs.fa look like:

>k141_4704 flag=0 multi=1.0000 len=301
TTCTGCAACACTTAAAGACATTCAAACTTTTTATGTTTGGGGTTACTGTAAAAACGATCAAATTAAGTGGTCCGTAGCCAAGGGTTTAATCGATAAAGAAGAATACACTTTGATCACTGGAGAAAAATATCCAGAAACAAAAGATGAAAAGTCACAGGTGTAATACTTGTGGCTTTTTAATTTGAATAAAGTGGGTGGCATAATGTTTGGATTTACCAAACGACATGAACAAGATTGGAGTTTAACGCGATTAGAAGAAAATGATAAGACTATGTTTGAAAAATTCGACAGAATAGAAGAT
>k141_10879 flag=1 multi=1.0000 len=301
GCAGTTAAGGCAGATCAAAATTTCAAGCGTACAGATGATAAGACTAAAGATGTTGAACTAAGTGATAATGATAAAAAATTACAAAAAACTATCAAGGTTGCTAAGAAGACTTTAGATTCGTTCGATAATGAAAAAGCAAAAGCTAAATTAGATGCTAAAATAGAAGATTTGAAACAAAAAGTATTAGAAGCAAGTTTTGAATTAAATCAATAAGATTCAAAAGAAGTTACACCAGAAGTTAAGTTAGAAAAACAAAAGTTAATTAAAGATATCACTGAAAAAGAAGCTAAGTTATCCGAAC
...

The final.graph.fastg file contains entries such as:

>NODE_1_length_205_cov_1.0000_ID_1;
TTCTGCAACACTTAAAGACATTCAAACTTTTTATGTTTGGGGTTACTGTAAAAACGATCAAATTAAGTGGTCCGTAGCCAAGGGTTTAATCGATAAAGAAGAATACACTTTGATCACTGGAGAAAAATATCCAGAAACAAAAGATGAAAAGTCACAGGTGTAATACTTGTGGCTTTTTAATTTGAATAAAGTGGGTGGCATAATGTTTGGATTTACCAAACGACATGAACAAGATTGGAGTTTAACGCGATTAGAAGAAAATGATAAGACTATGTTTGAAAAATTCGACAGAATAGAAGAT
>NODE_1_length_205_cov_1.0000_ID_1';
ATCTTCTATTCTGTCGAATTTTTCAAACATAGTCTTATCATTTTCTTCTAATCGCGTTAAACTCCAATCTTGTTCATGTCGTTTGGTAAATCCAAACATTATGCCACCCACTTTATTCAAATTAAAAAGCCACAAGTATTACACCTGTGACTTTTCATCTTTTGTTTCTGGATATTTTTCTCCAGTGATCAAAGTGTATTCTTCTTTATCGATTAAACCCTTGGCTACGGACCACTTAATTTGATCGTTTTTACAGTAACCCCAAACATAAAAAGTTTGAATGTCTTTAAGTGTTGCAGAA
>NODE_2_length_301_cov_1.0000_ID_3;
GCAGTTAAGGCAGATCAAAATTTCAAGCGTACAGATGATAAGACTAAAGATGTTGAACTAAGTGATAATGATAAAAAATTACAAAAAACTATCAAGGTTGCTAAGAAGACTTTAGATTCGTTCGATAATGAAAAAGCAAAAGCTAAATTAGATGCTAAAATAGAAGATTTGAAACAAAAAGTATTAGAAGCAAGTTTTGAATTAAATCAATAAGATTCAAAAGAAGTTACACCAGAAGTTAAGTTAGAAAAACAAAAGTTAATTAAAGATATCACTGAAAAAGAAGCTAAGTTATCCGAAC
>NODE_2_length_301_cov_1.0000_ID_3';
GTTCGGATAACTTAGCTTCTTTTTCAGTGATATCTTTAATTAACTTTTGTTTTTCTAACTTAACTTCTGGTGTAACTTCTTTTGAATCTTATTGATTTAATTCAAAACTTGCTTCTAATACTTTTTGTTTCAAATCTTCTATTTTAGCATCTAATTTAGCTTTTGCTTTTTCATTATCGAACGAATCTAAAGTCTTCTTAGCAACCTTGATAGTTTTTTGTAATTTTTTATCATTATCACTTAGTTCAACATCTTTAGTCTTATCATCTGTACGCTTGAAATTTTGATCTGCCTTAACTGC
...

Here:

  • k141_4704 corresponds to NODE_1_length_205_cov_1.0000_ID_1
  • k141_10879 corresponds to NODE_2_length_301_cov_1.0000_ID_3

The megahit module in agtools automatically resolves this mapping.

Files required:

  • GFA file - You can convert final.graph.fastg into GFA format using the agtools fastg2gfa subcommand.
  • Contigs file - final.contigs.fa

Once you convert the FASTG file to GFA format, you can load a MEGAHIT contig graph as follows. We will use the provided test data.

>>> from agtools.assemblers import megahit
>>> graph_file = "tests/data/5G/final.gfa"
>>> contig_file = "tests/data/5G/final.contigs.fa"
>>> cg = megahit.get_contig_graph(graph_file, contig_file)

You can get the contig name mapping between the graph file and the FASTA file as follows.

>>> cg.graph_to_contig_map
bidict({'NODE_1_length_205_cov_1.0000_ID_1': 'k141_4704', 'NODE_2_length_301_cov_1.0000_ID_3': 'k141_10879', 'NODE_3_length_301_cov_1.0000_ID_5': 'k141_9891', ...})

Given the contig name in the graph, you can get the contig name in the FASTA file as follows.

>>> cg.graph_to_contig_map['NODE_1_length_301_cov_1.0000_ID_1']
'k141_4704'

You can query the other way around as well. Given the contig name in the FASTA file, you can get the contig name in the graph as follows.

>>> cg.graph_to_contig_map.inverse['k141_4704']
['NODE_1_length_205_cov_1.0000_ID_1']

Note

graph_to_contig_map is a bidirectional dictionary. Hence, you can query both ways: contig names from graph to FASTA and from FASTA to graph.

You can get the contig sequences using the contig name in the graph as follows.

>>> cg.get_contig_sequence('NODE_1_length_205_cov_1.0000_ID_1')
Seq('CGCCCTCGCTCATGCACGATTGCGAAGGCTCCGGCATGCCATCTGAAGAAACAG...GAA')

Note that the contigs have some descriptions after the name in the FASTA file. You can get them as follows.

>>> cg.contig_descriptions['k141_4704']
'k141_4704 flag=0 multi=1.0000 len=205'

Flye contig graph

Flye contig graphs follow a similar structure to SPAdes, but links represent direct continuations rather than overlaps. Similar to SPAdes, agtools builds the contig graph based on prefix and suffix matching of contigs, i.e., if the last segment of the first contig matches the first segment of the second contig, then a link between the two contigs is created.

Files required:

  • GFA file - assembly_graph.gfa
  • Contigs file - assembly.fasta
  • Contig paths file - assembly_info.txt

You can load a Flye contig graph as follows. We will use the provided test data.

>>> from agtools.assemblers import flye
>>> graph_file = "tests/data/1Y3B/assembly_graph.gfa"
>>> contigs_file = "tests/data/1Y3B/assembly.fasta"
>>> contig_paths_file = "tests/data/1Y3B/assembly_info.txt"
>>> cg = flye.get_contig_graph(graph_file, contigs_file, contig_paths_file)

You can check the number of vertices (contigs), edges (connections) and number of link lines in the GFA file.

>>> cg.vcount
67
>>> cg.ecount
2
>>> cg.lcount
10

Note

There are fewer contigs than segments (S tags) in the graph (67 contigs and 69 segments in this example). This is because Flye resolves longer segment paths as contigs. Each contig is made up of one or more segments.

Note

There are fewer edges than links (L tags) in the graph (2 edges and 10 links in this example). This is because agtools only represents prefix-suffix overlaps of contigs. Also, the graph is undirected and simplified to remove duplicate edges.

myloasm contig graph

myloasm outputs contig graphs directly, where segments represent contigs and links represent overlaps, so they are straightforward to interpret.

Files required:

  • GFA file - final_contig_graph.gfa
  • Contigs file - assembly_primary.fa
>>> from agtools.assemblers import myloasm
>>> graph_file = "tests/data/myloasm/final_contig_graph.gfa"
>>> contigs_file = "tests/data/myloasm/assembly_primary.fa"
>>> cg = myloasm.get_contig_graph(graph_file, contigs_file)

Warning

Not all contigs in the final_contig_graph.gfa file appear in assembly_primary.fa, because contigs that are similar to larger contigs are removed (see GitHub issue). Also, some contig sequences are not present in the GFA file. This can raise warnings when retrieving contig sequences. Hence, it is recommended to run agtools clean to remove missing contigs and add back contig sequences to the GFA file.

You can check the number of vertices (contigs), edges (connections), the number of link lines, and the contig names:

>>> cg.vcount
2
>>> cg.ecount
1
>>> cg.lcount
2
>>> cg.contig_names
['u913838ctg', 'u579439ctg']
>>> cg.contig_name_to_id
{'u913838ctg': 0, 'u579439ctg': 1}